Back

MLVA-typing

MLVA for Enterococcus faecium

We suggest to use MLVA as an initial screening and typing method of E. faecium isolates in hospital laboratories. Subsequently, representative isolates can be subjected to MLST, to get insight in the global epidemiology of particular MLVA profiles.

For a description of the MLST typing method see the following website:  Multi Locus Sequence Typing

The MLVA database is no longer curated. For questions, please contact Janetta Top:

 j.top@umcutrecht.nl 

Department of Medical Microbiology
University Medical Center Utrecht (UMC)
P.O. Box 85500
3508GA Utrecht
The Netherlands

Phone: +31 30 2507627
Fax:+31 30 2541770
E-mail:  j.top@umcutrecht.nl 

MLVA gel analyses

Five microliters of the PCR mixture was analyzed on agarose gels with different percentage of agarose depending on the size of the VNTR marker (see VNTR characteristics). The number of repeats was determined by visual interpretation of the band size using a 50-, 100-bp or 1-kb ladder as size marker (Invitrogen, USA). 

 

DNA preparation and VNTR PCR

Bacterial isolates were grown overnight on Columbia blood agar plates. Three colonies of bacterial cells were suspended in 20 μl lysis buffer (0.25% SDS, 0.05 N NaOH) and incubated at 95˚C for 5 min. The cell lysate was spin by short centrifugation and diluted with 180 μl buffer (10 mM Tris-DCl, pH 8.5). After thoroughly mixing, another centrfugation for 5 min at 16,000 x g was performed to remove cell debris. Supernatants were frozen at -20˚C until further use. Two and a half μl of the lysate was used in the PCR reaction.

From isolates that did not yield a PCR product, chromosomal DNA was extracted using the QiaAmp Blood kit (Qiagen inc., Valencia, CA, USA) according to the manufacturers instruction for Gram-positive bacteria with some minor changes in the lyses of the bacteria. From an overnight culture 1.5 ml was spin for 2 min, suspended in 200 µl of 10 mM Tris-1 mM EDTA pH8.0 and 10 µl of a 50-mg/ml solution of egg white lysozym (Roche) and incubated at 37˚C for 15 min. The bacteria were lysed by the addition of 30 µl of 10% sodium dodecyl sulfate and 20 µl of a 20-mg/ml proteinase K (Merck) solution and incubated at 65˚C for 1 hour. Subsequently, the protocol according to the manufacturers instructions was used.

The PCR conditions were not the same for all of the amplification reactions. In all cases the initial denaturation was at 95˚C for 15 min and a final extension of 5 min at 72˚C.

Alterations: The extention times are increased, the VNTR 8 and 9 PCR programs are now the same as VNTR 7 and 10. After the TD part, the remaining cycles increased from 25 to 30 cycles.

For VNTR-1, 35 cycles of 30 s at 94˚C, 30 s at 52˚C and 1 min at 72˚C were performed.
For VNTRs 2 a Touch Down (TD) PCR was developed that included 10 cycles of 30 s 94˚C, 30 s 70˚C (see below) and 4 min 72˚C. The annealing temperature during the first cycle was 70˚C and decreased 1˚C at each cycle during the next 9 cycles. During the remaining 30 cycles, an annealing temperature of 60˚C was used.
Note: For some strains it is difficult to obtain a PCR product for VNTR-2. When we used Ready-to-go beads from Amersham instead of HotStarMastermix, in most cases a positive result was obtained.

For VNTRs 7, 8, 9 and 10 the initial annealing temperature was 65˚C and decreased to 55˚C. Extention is 1 min at 72˚C. Reactions were performed in 25 µl volumes with HotStar Taq polymerase and HotStar Master Mix buffers from Qiagen (Qiagen inc.). 

VNTR characteristics and specific primers

LocusnameRepeat length (bp) Range no. repeats No. of allels% conservationPrimer sequence PCR program Estimatd size (bp) % agarose gel
VNTR-11230-8895F:CTGTGATTTGGAGTTAGATGG
R:CATTGTCCAGTAGAATTAGATTTG
30 cycli
52 C
250-10122
VNTR-22791-141396F:GATGCTTATTTCCACTGCTTGTTG
R:GTTTTACCCTCTCTTTTAAGGTCAATG
TD
70-60
724-43511
VNTR-71211-7798F: CTATCAGTTTCAGCTATTCCATC
R: CTGGTACGAATCAAATCAAGTG
TD
65-55
416-10212
VNTR-81211-7796F: GGGGAGTGGCAAAAAATAGTGTG
R: CAGATCATCAACTATCAACCGCTG
TD
65-55
237-9632
VNTR-91211-3393F:CTGCATCTAATAACAAGGACCCATG
R: ACATTCCGATTAACGCGAAATAAG
TD
65-55
205-4472
VNTR-101210-3496F: CCTACAGAAAATCCAGACGG
R: TTTTTTCCATCCTCT TGAATTG
TD
65-55
174-4742

 

Band size/No. repeats

Determination of repeatnumbers according to bandsize

Locus VNTR-1, repeat length: 123 bp

Band size (bp)Number of repeats
2500 (flank)
2741
3972
5203
6434
7665
8896
10127

Locus VNTR-2, repeat length: 279 bp
Band size (bp)Number of repeats
5040 (flank)
7241
10032
12823
15614
18405
21196
23987
26778
29569

Locus VNTR-7, repeat length: 121 bp
Band size (bp)Number of repeats
3810 (flank)
4161
5372
6583
7794

Locus VNTR-8, repeat length: 121 bp
Band size (bp)Number of repeats
1970 (flank)
2371
3582
4793
6004
7215
8426
9637

Locus VNTR-9, repeat length: 121 bp
Band size (bp) Number of repeats
1580 (flank)
2051
3262
4473
5684

Locus VNTR-10, repeat length: 120 bp
Band soze (bp) Number of repeats
1740 (flank)
2341
3542
4743
5944